ID: 940700643

View in Genome Browser
Species Human (GRCh38)
Location 2:157038118-157038140
Sequence CTGGTTAGACAGACTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940700643_940700646 -2 Left 940700643 2:157038118-157038140 CCTTGGGAAGTCTGTCTAACCAG No data
Right 940700646 2:157038139-157038161 AGATAACTGGTTGTATAAATAGG No data
940700643_940700648 16 Left 940700643 2:157038118-157038140 CCTTGGGAAGTCTGTCTAACCAG No data
Right 940700648 2:157038157-157038179 ATAGGGCAAAACTTTTTAATAGG No data
940700643_940700649 17 Left 940700643 2:157038118-157038140 CCTTGGGAAGTCTGTCTAACCAG No data
Right 940700649 2:157038158-157038180 TAGGGCAAAACTTTTTAATAGGG No data
940700643_940700647 -1 Left 940700643 2:157038118-157038140 CCTTGGGAAGTCTGTCTAACCAG No data
Right 940700647 2:157038140-157038162 GATAACTGGTTGTATAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940700643 Original CRISPR CTGGTTAGACAGACTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr