ID: 940701738

View in Genome Browser
Species Human (GRCh38)
Location 2:157053215-157053237
Sequence CTGAAGAGCTGGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940701733_940701738 12 Left 940701733 2:157053180-157053202 CCAGGCATTCTTTTAGTAGCCCA No data
Right 940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG No data
940701734_940701738 -7 Left 940701734 2:157053199-157053221 CCCATGTAAGATGTTACTGAAGA No data
Right 940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG No data
940701735_940701738 -8 Left 940701735 2:157053200-157053222 CCATGTAAGATGTTACTGAAGAG No data
Right 940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940701738 Original CRISPR CTGAAGAGCTGGAGAGAAGA GGG Intergenic
No off target data available for this crispr