ID: 940705092

View in Genome Browser
Species Human (GRCh38)
Location 2:157094857-157094879
Sequence ACTGAGAGATTCCAGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940705092_940705097 19 Left 940705092 2:157094857-157094879 CCAGGGTGCTGGAATCTCTCAGT No data
Right 940705097 2:157094899-157094921 AGAGGTACTCTCATCAGTGGTGG No data
940705092_940705096 16 Left 940705092 2:157094857-157094879 CCAGGGTGCTGGAATCTCTCAGT No data
Right 940705096 2:157094896-157094918 CACAGAGGTACTCTCATCAGTGG No data
940705092_940705098 20 Left 940705092 2:157094857-157094879 CCAGGGTGCTGGAATCTCTCAGT No data
Right 940705098 2:157094900-157094922 GAGGTACTCTCATCAGTGGTGGG No data
940705092_940705093 1 Left 940705092 2:157094857-157094879 CCAGGGTGCTGGAATCTCTCAGT No data
Right 940705093 2:157094881-157094903 TTACTCCAGAGTTGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940705092 Original CRISPR ACTGAGAGATTCCAGCACCC TGG (reversed) Intergenic
No off target data available for this crispr