ID: 940708783

View in Genome Browser
Species Human (GRCh38)
Location 2:157136533-157136555
Sequence GTTTAGGTTTAGCAGTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940708781_940708783 -5 Left 940708781 2:157136515-157136537 CCTAAGGATACTCATAAAGTTTA No data
Right 940708783 2:157136533-157136555 GTTTAGGTTTAGCAGTCATAAGG No data
940708779_940708783 28 Left 940708779 2:157136482-157136504 CCATAAATGTTTGGGGATTGACT No data
Right 940708783 2:157136533-157136555 GTTTAGGTTTAGCAGTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940708783 Original CRISPR GTTTAGGTTTAGCAGTCATA AGG Intergenic