ID: 940716679

View in Genome Browser
Species Human (GRCh38)
Location 2:157233769-157233791
Sequence CTGTAGGCACAAAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940716679_940716681 25 Left 940716679 2:157233769-157233791 CCATCATCACTTTGTGCCTACAG No data
Right 940716681 2:157233817-157233839 CTTAAGCAATACATTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940716679 Original CRISPR CTGTAGGCACAAAGTGATGA TGG (reversed) Intergenic
No off target data available for this crispr