ID: 940725060

View in Genome Browser
Species Human (GRCh38)
Location 2:157327697-157327719
Sequence CAGTAGAGACAGTTGTGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940725053_940725060 14 Left 940725053 2:157327660-157327682 CCAGAGATCCCACAGGGGTTCGG 0: 1
1: 0
2: 1
3: 7
4: 64
Right 940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 324
940725049_940725060 21 Left 940725049 2:157327653-157327675 CCTTGGACCAGAGATCCCACAGG 0: 1
1: 1
2: 0
3: 25
4: 222
Right 940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 324
940725056_940725060 5 Left 940725056 2:157327669-157327691 CCACAGGGGTTCGGCATTAGCAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 324
940725055_940725060 6 Left 940725055 2:157327668-157327690 CCCACAGGGGTTCGGCATTAGCA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940725060 Original CRISPR CAGTAGAGACAGTTGTGGCC AGG Exonic
900184437 1:1326314-1326336 AAGCAGAGACAGGTGGGGCCGGG - Intronic
900656835 1:3762790-3762812 CAGCAGGGACACTTGGGGCCTGG - Intronic
901202810 1:7476224-7476246 CAGCAGAGACAGGAGTGGCCAGG + Intronic
901329231 1:8391842-8391864 TAGTAGAGACAGGGTTGGCCAGG - Intronic
903099723 1:21018386-21018408 TAGTAGAGACTGTGTTGGCCAGG - Intronic
903818429 1:26082073-26082095 GAGTTGAGCCAGATGTGGCCTGG + Intergenic
904147789 1:28408463-28408485 CAGGAGAAACACTTGAGGCCTGG + Intronic
904202237 1:28828029-28828051 CATTAGGTACATTTGTGGCCAGG - Intronic
905886145 1:41493245-41493267 CAGTGGAGACAGTACTTGCCTGG + Intergenic
910487512 1:87731738-87731760 GAGTAGAGAGATTAGTGGCCAGG + Intergenic
910794009 1:91080039-91080061 AAGAAGACACAGTTTTGGCCGGG + Intergenic
910986991 1:93014882-93014904 CCTTACAGACAGGTGTGGCCTGG - Intergenic
911124774 1:94330931-94330953 CAGGAGGGTCAGTTGAGGCCAGG - Intergenic
911642498 1:100304068-100304090 TAGTAGAGACAGGGTTGGCCTGG - Intergenic
914813854 1:151048636-151048658 CAGTACAGAGACTTGTGTCCAGG - Exonic
914939155 1:152006880-152006902 CAGCAGGGAAAGTCGTGGCCTGG + Intergenic
915293088 1:154899438-154899460 TAGGAGAGACTGTGGTGGCCTGG - Intergenic
916912489 1:169365996-169366018 CATTTGAGACAGATGTGTCCGGG + Intronic
917622806 1:176814796-176814818 CAGTATTGAAAGTTCTGGCCAGG - Intronic
919106584 1:193159551-193159573 TAGTAGAGACTGTATTGGCCAGG + Intronic
919478337 1:198056084-198056106 CAGTAGTGACAGTGGTGGGCAGG + Intergenic
919633824 1:199984666-199984688 CATTAGAGCCAGTGGTGTCCAGG - Intergenic
919896881 1:202014518-202014540 CAGGAGAGTCATTTGAGGCCAGG - Intronic
919954804 1:202403145-202403167 CAGTAGAGAGAGATGGGGCCTGG + Intronic
919995178 1:202741432-202741454 CAGTGGAGAAAGCTATGGCCCGG - Exonic
920417612 1:205809391-205809413 GAGGAGAGACAGTTCTGCCCAGG + Intronic
920426357 1:205879680-205879702 CAGTAGAGACAGTGGTGGGCTGG + Intergenic
922173549 1:223177532-223177554 CAGTGGAGGCAGGTGTGGGCAGG - Intergenic
922237760 1:223734596-223734618 AAGGAGAGAGGGTTGTGGCCGGG - Intronic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
922582749 1:226710825-226710847 CAGAAGAGTCAGTAGTTGCCAGG + Intronic
922805638 1:228387315-228387337 TAGAACACACAGTTGTGGCCAGG - Intergenic
923017638 1:230139324-230139346 CAGAAGGGACACATGTGGCCAGG - Intronic
923349515 1:233089925-233089947 CAAGAGAGACAGGTTTGGCCTGG + Intronic
923568065 1:235091504-235091526 CTCTAGAGAGAGATGTGGCCAGG + Intergenic
923669555 1:236028879-236028901 TAGTACATACAGATGTGGCCGGG + Intronic
923800567 1:237205047-237205069 CAGTAGGGCCAGGTGGGGCCTGG + Intronic
1062821929 10:541430-541452 CAGGAGAGACGGGTGTGGTCGGG - Intronic
1062821989 10:541650-541672 CAGGAGAGACGGGTGTGGTCGGG - Intronic
1062822025 10:541786-541808 TAGGAGAGACAGGTGTGGTCAGG - Intronic
1063081398 10:2770903-2770925 GAGGAGAGTCAGTTGTGGGCAGG + Intergenic
1063535853 10:6882681-6882703 TAGAAGAGACAGTTGGGTCCTGG + Intergenic
1064307976 10:14185829-14185851 CAGTGGAGACAGCCATGGCCAGG + Intronic
1064376268 10:14799426-14799448 TAGTATAGAAAATTGTGGCCAGG + Intergenic
1064646426 10:17464612-17464634 CAGGAGAGATAGTGGTGGCCTGG - Intergenic
1064688462 10:17888963-17888985 CAGTAGAGACTGTTATGTCTTGG + Intronic
1067027605 10:42858140-42858162 CAGCAGAGCCTGTTGTGGCCTGG + Intergenic
1067989733 10:51198124-51198146 CAGTAGTCACAGTTTTGGGCAGG + Intronic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1071871225 10:89796735-89796757 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073138266 10:101231382-101231404 GAGTAGAGACAGGTCTGCCCTGG - Intergenic
1073189601 10:101641863-101641885 CAATAGACACACATGTGGCCAGG + Intronic
1077562928 11:3275912-3275934 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
1077568821 11:3321728-3321750 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
1078234663 11:9473093-9473115 GAGTAAAGACATTTGGGGCCGGG + Intronic
1078748530 11:14138462-14138484 CAGTAGTGACACTAGTGGCTGGG + Intronic
1079262968 11:18901242-18901264 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1079267423 11:18947279-18947301 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1080757441 11:35215688-35215710 TAGTAGAGACAGGGTTGGCCAGG - Intronic
1081506237 11:43719990-43720012 AAGTAAAGACAGTTCTGTCCTGG - Intronic
1081556915 11:44172763-44172785 TAGTAGAGACAGGGTTGGCCAGG + Intronic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1083446522 11:62711221-62711243 TAGTAGAGACAGTTTTCACCGGG - Intronic
1084243326 11:67837667-67837689 TAGTAGAGACAGGGTTGGCCAGG - Intergenic
1084707562 11:70824151-70824173 CACGGGAGACAGTTGTGACCCGG + Intronic
1085139920 11:74130459-74130481 CAGTAGGGTCATTTGAGGCCAGG - Intronic
1086319956 11:85635229-85635251 TAGTAGAGACTGTGTTGGCCAGG - Intronic
1087063517 11:94006320-94006342 TAGTATAGGCAGTTCTGGCCAGG - Intergenic
1087666602 11:101056409-101056431 CAGGAGAGTCACTTGAGGCCAGG + Intronic
1088096433 11:106106093-106106115 CAGGTGAGGCAGTGGTGGCCTGG - Intergenic
1088939307 11:114437515-114437537 AAGTAGAGTCAGTTGAGGCCAGG - Intronic
1089490942 11:118883658-118883680 CAGTTGAGACAATTATTGCCGGG + Intergenic
1089750085 11:120645457-120645479 CAGTATAGGCAGTGGTGGCATGG - Intronic
1090415073 11:126535015-126535037 CAGCAGTGACAGGTGTGGCCTGG + Intronic
1090802921 11:130184990-130185012 CAGTGAAGCCAGTTGTGGCAAGG + Intronic
1091413771 12:262251-262273 CTGTAGAGTCAGATGAGGCCAGG + Intronic
1092515264 12:9204865-9204887 CAGGAGAGTCACTTGAGGCCAGG + Intronic
1093141257 12:15512764-15512786 CAGGAGAGGCACTTGAGGCCAGG + Intronic
1094576105 12:31687169-31687191 CAGTAAGGACACTGGTGGCCGGG - Intronic
1097633075 12:62087825-62087847 CAGTAGGGACGGTGGTGGCTTGG + Intronic
1098225738 12:68321015-68321037 CAGTTGAGACAGTGGAGGTCTGG + Intronic
1098527406 12:71501599-71501621 CAATAAAAACAGCTGTGGCCTGG - Intronic
1099715660 12:86290226-86290248 CAGTAGAGACGGGTTTGGCCAGG + Intronic
1100677874 12:96887599-96887621 CAGCAGTGACACTGGTGGCCAGG - Intergenic
1102137110 12:110584273-110584295 CAGTAGAGACCATGTTGGCCAGG - Intergenic
1102849711 12:116229070-116229092 TAGAAGAGGCTGTTGTGGCCTGG - Intronic
1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG + Intergenic
1104682721 12:130762411-130762433 CAGTGGGGACATTTGTGGCAGGG + Intergenic
1104838514 12:131808438-131808460 CTAAAGAGACATTTGTGGCCGGG + Intergenic
1104899155 12:132178909-132178931 CAGGAGAGGCAGGTGCGGCCCGG - Intergenic
1105553005 13:21415857-21415879 CAGTAGAGAGGCTTGAGGCCTGG - Intronic
1105954068 13:25263402-25263424 CAATAGACACAGCTGTGGGCAGG + Intronic
1106736333 13:32591308-32591330 TAGTAGAGACTGTGTTGGCCAGG + Intronic
1109390369 13:61684273-61684295 CAGGAGAGTCACTTGAGGCCAGG + Intergenic
1110216948 13:73033930-73033952 TAGTAGAGACAGGTTTAGCCAGG - Intergenic
1110976809 13:81847675-81847697 CAGAATATACAGTTTTGGCCGGG - Intergenic
1112076495 13:95919346-95919368 CAGTATTGAAAGTTCTGGCCAGG + Intronic
1112307769 13:98290650-98290672 GAGTTGGGACAGTAGTGGCCAGG + Intronic
1114260206 14:21031144-21031166 CAGTAGCGCCAGTGGTGGCTGGG - Exonic
1114467315 14:22932372-22932394 CAGTATGGAAAGTTGGGGCCGGG - Intergenic
1115537535 14:34387059-34387081 CAGTAGGGACATTTGTCACCTGG + Intronic
1115653545 14:35421301-35421323 TAGTAGAGACGGTGTTGGCCAGG - Intergenic
1116464229 14:45213197-45213219 CAGAAGAAACAATTCTGGCCGGG - Intronic
1118338569 14:64876321-64876343 TAGTAGAGATAGGTTTGGCCAGG + Intronic
1118950433 14:70431989-70432011 CAGTGGAGAAAGGTGTGGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119469988 14:74890307-74890329 TTGTAGAGACAGGTGTTGCCAGG + Intronic
1120201994 14:81547416-81547438 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1122104285 14:99440450-99440472 CAGTAGAGCCAGTAGGGGACAGG + Intronic
1122542287 14:102505226-102505248 AAGTGGAGACAGGAGTGGCCTGG - Exonic
1122777701 14:104129349-104129371 CAGAAGGGTCACTTGTGGCCAGG - Intergenic
1123424183 15:20155867-20155889 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1123533403 15:21162396-21162418 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1124201370 15:27681232-27681254 CAGTAGGGGCTGTTTTGGCCGGG + Intergenic
1125210584 15:37210383-37210405 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
1125761317 15:42097421-42097443 GAGAAGAGACAGTGGTGGCAAGG - Intergenic
1126252686 15:46587824-46587846 CAGCAGTGACAGTGGTGGGCTGG + Intergenic
1128800504 15:70493960-70493982 CAGCAAAGCCAGTGGTGGCCCGG + Intergenic
1129426365 15:75466325-75466347 CAGTTGGGGCAGTTGTGGCTGGG - Exonic
1132490286 16:225190-225212 CAGAAAACACAGTTCTGGCCGGG + Intronic
1133816022 16:9198169-9198191 CAGGAGAGTCACTTGAGGCCAGG - Intergenic
1134208203 16:12254456-12254478 CAGTAGAGACGGGGATGGCCAGG - Intronic
1134691943 16:16196882-16196904 CAGTAGAGACGGGGTTGGCCAGG + Intronic
1135265895 16:21025129-21025151 TAGTAGAGACAGGGTTGGCCAGG + Intronic
1135503237 16:23015044-23015066 CAGTAGAGACAGCACTGCCCTGG + Intergenic
1136181983 16:28559565-28559587 TAGTAGAGACAGTGTTGGCCAGG + Intronic
1136659490 16:31744136-31744158 CAGTATTGAAAGTTCTGGCCAGG - Intronic
1136857033 16:33666838-33666860 CAGCAGAGCCTGTTGTGGCCTGG - Intergenic
1136860686 16:33700019-33700041 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1137268578 16:46887563-46887585 GAGTATAAACAGATGTGGCCTGG + Intronic
1138165042 16:54793512-54793534 CAGCAGAGAGAACTGTGGCCAGG + Intergenic
1139786906 16:69400546-69400568 CATTAAAGAAAGTTCTGGCCAGG - Intronic
1140812444 16:78591394-78591416 CACTGGAGACAGTTGTGTACTGG - Intronic
1140847510 16:78904529-78904551 CAGAAAAGACATTTATGGCCAGG - Intronic
1141561460 16:84870761-84870783 CATTATAAACAGTTGCGGCCAGG + Intronic
1142312894 16:89324118-89324140 CAGTAGAGAGCGTTGTGCCGTGG - Intronic
1203118608 16_KI270728v1_random:1515313-1515335 CAGCAGAGCCTGTTGTGGCCTGG - Intergenic
1203122185 16_KI270728v1_random:1548202-1548224 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1142617801 17:1146699-1146721 CAGTAGTGGCAGTGGTGGCATGG - Intronic
1142617831 17:1146842-1146864 CAGTGGTGGCAGTGGTGGCCTGG - Intronic
1143985604 17:10911033-10911055 TAGTAGAGACAGGGTTGGCCAGG - Intergenic
1144624678 17:16838700-16838722 CAGTAGAGGCAGTGGTTGCCAGG - Intergenic
1144881752 17:18434021-18434043 CAGTAGAGGCAGTGGTTGCCAGG + Intergenic
1145150481 17:20510365-20510387 CAGTAGAGGCAGTGGTTGCCAGG - Intergenic
1147477026 17:40721827-40721849 CAGTAGAGGCAGATGTGGTCTGG - Intergenic
1147635045 17:41958829-41958851 TAGTAGAGACAATGTTGGCCAGG - Intronic
1148077430 17:44946925-44946947 TAGTAGAGACAGGGTTGGCCGGG - Intronic
1151404360 17:73877146-73877168 CAGAAGAGGCAGTTCTGGCCTGG - Intergenic
1151645061 17:75424927-75424949 CAGGAGAGTCAGTTGAAGCCGGG + Intergenic
1153901885 18:9624430-9624452 CAGTAGAACCACTTGAGGCCAGG + Intergenic
1155250029 18:23945442-23945464 GAGAAGAGGCAGATGTGGCCAGG + Intronic
1155924073 18:31635047-31635069 TAGTAGAGACAGGGTTGGCCAGG - Intronic
1157253360 18:46115922-46115944 TAGTAGAGACAGGGTTGGCCAGG - Intronic
1157580812 18:48773206-48773228 CAGTTGAGAGACTTGAGGCCTGG + Intronic
1157669981 18:49520149-49520171 CAGCATAGAAAGTTCTGGCCTGG + Intergenic
1158363769 18:56707276-56707298 CAGTAAAGTCAGTTGAGGCTGGG - Intronic
1159078715 18:63711017-63711039 CAGTAGGGACAGAAGTGTCCAGG + Intronic
1159242007 18:65753163-65753185 CAGTAAAGACACTAGTGCCCAGG - Intronic
1160168457 18:76532830-76532852 CAGATGAGAAAATTGTGGCCTGG - Intergenic
1160398105 18:78586888-78586910 CACTAGAGACACCTGTGGCCTGG + Intergenic
1160614184 18:80111366-80111388 CAGAAGAGCCAGCTGAGGCCTGG + Intronic
1161409003 19:4106176-4106198 CAGGAGGGTCACTTGTGGCCAGG + Intronic
1161419195 19:4166689-4166711 CAATAGAAACAGATGGGGCCAGG - Intronic
1161475039 19:4480018-4480040 TAGCAGTGACAGTTGGGGCCAGG + Intronic
1161664145 19:5564871-5564893 CAGAGGAGACAGTTTTGGCTGGG - Intergenic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162524478 19:11199435-11199457 CAGCACAGACAGCTGAGGCCCGG + Exonic
1164360246 19:27499408-27499430 CACTGGAGACTGTTGTGGCGGGG + Intergenic
1164676061 19:30102370-30102392 TTGTAGAGGCAGGTGTGGCCTGG + Intergenic
1165486710 19:36100976-36100998 GAGTGGGGACAGTTGAGGCCTGG + Intronic
1165609064 19:37134417-37134439 CAGGACAGACAGTAGTGTCCAGG + Intronic
1166782969 19:45351938-45351960 CAGGAGAGACGGTGCTGGCCTGG - Intronic
1168678020 19:58293128-58293150 TAGTAGAGACAGGGTTGGCCAGG + Intronic
925195398 2:1919909-1919931 TAGTAGAGACAGTGTTAGCCAGG + Intronic
925210734 2:2043523-2043545 AACTGGAGGCAGTTGTGGCCGGG - Intronic
925465656 2:4105524-4105546 CAGTAGAGCCAGCTGTGGAGGGG + Intergenic
925615806 2:5743585-5743607 CAGGTGAGACAGGTGTGTCCTGG + Intergenic
927682152 2:25146771-25146793 GAGTGGAGAGAGTTGTGGCATGG - Intronic
927778272 2:25918905-25918927 GAGAAGAGAAAGTTGTTGCCAGG + Intergenic
929971022 2:46576825-46576847 CAGAAGAGACAGTGGAGGCTGGG + Intronic
930768132 2:55105742-55105764 CAGGAGAAACACTTGTGACCAGG + Intronic
930787526 2:55285194-55285216 CAGTAGGATCAGTTGAGGCCAGG + Intergenic
930835226 2:55785686-55785708 GAGGAGAGACAATGGTGGCCTGG - Intergenic
932086140 2:68764056-68764078 CTGTAGAGACAGTGGTTGCCAGG - Intronic
933151460 2:78919983-78920005 CAGTACAGACAGACGTGGTCAGG - Intergenic
933780169 2:85795662-85795684 CAGTAGAGTCAGGTGTGGGAGGG + Intergenic
934459066 2:94201172-94201194 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
934505860 2:94893078-94893100 ATGTAGAGATAGATGTGGCCTGG - Intergenic
934768041 2:96891634-96891656 GAGGAGAGAAAGTTGTGCCCTGG + Intronic
935214701 2:100966890-100966912 CAGAAGAGAAAGTTCTAGCCAGG - Intronic
939018925 2:136935798-136935820 CAGTTGGGACAATTATGGCCAGG + Intronic
939646950 2:144711786-144711808 CAGTGGAGCCAGTTCTGCCCAGG + Intergenic
940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG + Exonic
940780351 2:157926606-157926628 TAGTAGAGACAGGGCTGGCCAGG + Intronic
941628339 2:167855388-167855410 CAGAAGAGAAAGCTGAGGCCTGG - Intergenic
942729074 2:179043789-179043811 CAGTATTGGAAGTTGTGGCCAGG + Intronic
944237453 2:197453318-197453340 CAGGAGAGAGAGGTGTGTCCTGG + Intergenic
944306704 2:198187661-198187683 CAGCAGAGACAGGTGAGGGCTGG - Intronic
944594760 2:201250948-201250970 CTATAGAGACAGTGGTTGCCAGG - Intronic
945005125 2:205397026-205397048 CAGTAGTGGCAGTAGTGGACCGG - Intronic
945994812 2:216427236-216427258 CAGTAGAGACAGTCGTTGTCAGG + Intronic
1171210620 20:23314091-23314113 CAGGAGAGTCAGTTGAGCCCAGG - Intergenic
1172012801 20:31856266-31856288 GAGTGGAGACAGATGAGGCCAGG + Intronic
1173991984 20:47310602-47310624 TAGTAGAGACGGTATTGGCCAGG - Intronic
1175514715 20:59561663-59561685 CAGAAGAGACAGTTCTGGTATGG + Intergenic
1175541679 20:59751767-59751789 CAGTGGAGCCCGTTGTGCCCTGG + Intronic
1177539070 21:22468167-22468189 TAGTAGAGACTGGTTTGGCCAGG + Intergenic
1179146323 21:38771178-38771200 CAATAGAGACAGTCGTTTCCAGG + Intergenic
1180588772 22:16917948-16917970 AAGTAAACACAGTTTTGGCCGGG + Intergenic
1181357150 22:22305297-22305319 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1182301957 22:29341963-29341985 GAGTAGAGACAGGCATGGCCAGG - Intronic
1182508342 22:30801744-30801766 CAGCAGAGTCACTTGAGGCCAGG + Intronic
1182699584 22:32224717-32224739 CAGTGTAGACAGTAGTGTCCTGG - Intronic
949937032 3:9123947-9123969 AAGGAGAGACAGTGCTGGCCGGG + Intronic
950648177 3:14390695-14390717 TAGTAGAGACCGTGTTGGCCAGG + Intergenic
950896767 3:16459224-16459246 CAGAAAACACAGTAGTGGCCAGG - Intronic
951931203 3:27968910-27968932 AAGAATAGACAGTTATGGCCAGG - Intergenic
952273342 3:31853581-31853603 AAGTAGAGTCAGTTCTGGGCTGG - Intronic
952341454 3:32451043-32451065 CAGTGCAGACAGTTGGGGACCGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953839107 3:46374514-46374536 CAGGCGAGAGACTTGTGGCCTGG + Exonic
954183972 3:48902768-48902790 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
954996699 3:54888345-54888367 AAGTAGAGAGAGCTGTGGCGAGG - Intronic
955050720 3:55408063-55408085 CAGAGGAGACAGCAGTGGCCAGG - Intergenic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
957728881 3:84106293-84106315 CAGTAGAACCTGTTGTTGCCAGG + Intergenic
957744825 3:84326409-84326431 AAGTGGAGACAGATGTAGCCAGG + Intergenic
961338621 3:126201763-126201785 CTGTAGAGACTGTTTTGCCCAGG - Intergenic
961659836 3:128462867-128462889 CAATAGTGACCGTGGTGGCCGGG - Exonic
962492377 3:135907079-135907101 TAGAAGAGACAGAAGTGGCCAGG + Intergenic
962521795 3:136203960-136203982 TAGTAGAGACTGTGTTGGCCAGG + Intergenic
962830846 3:139138303-139138325 TAGTAAAGAAAGTTTTGGCCAGG - Intronic
962879760 3:139565518-139565540 CAGTAGGGACTGTTGTGGGGTGG - Intronic
963083594 3:141416743-141416765 CAGTAGAGACACTTGTAGAAAGG + Intronic
964019092 3:151985226-151985248 CAGTATTGACAGTTATGGCTTGG + Intergenic
965178938 3:165375342-165375364 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
965421504 3:168464762-168464784 CAGTATAGAAAGTTCTGGTCGGG + Intergenic
965722110 3:171673460-171673482 TAGTAGAGACAGGGTTGGCCAGG + Intronic
966729738 3:183140799-183140821 CAGTAGGGAAATTTGGGGCCAGG - Intronic
966807100 3:183816259-183816281 CACTAGAGCCACTTGTGGGCTGG + Exonic
967943851 3:194786916-194786938 CAGTAGAGAGGGTGGGGGCCTGG + Intergenic
967949944 3:194833043-194833065 CAGTAGGGCCAGCTGTGGACTGG - Intergenic
967988475 3:195113771-195113793 CAGGAGAAAGGGTTGTGGCCAGG + Intronic
968785129 4:2615990-2616012 TAGTAGAGACAGTGTTGCCCAGG + Intronic
970218981 4:13787858-13787880 AAGTATAGAAAATTGTGGCCAGG - Intergenic
970917834 4:21356299-21356321 CAGTATTGGAAGTTGTGGCCAGG + Intronic
971147790 4:23997681-23997703 TAGTAGAGACAGGTTTGCCCAGG + Intergenic
973778555 4:54266751-54266773 CAGGAGAGTCACTTGAGGCCAGG + Intronic
978206542 4:106087061-106087083 CAGTATAGGAAGTTCTGGCCAGG + Intronic
978388748 4:108202695-108202717 CAGTAGAGACGGGTTTCGCCAGG - Intergenic
978653159 4:111032534-111032556 CATAAGAGAAAGTTCTGGCCAGG - Intergenic
982861242 4:160451987-160452009 CAGTAGAGACAGGAGACGCCAGG - Intergenic
983478026 4:168239953-168239975 CAGTATTGAAAGTTCTGGCCAGG + Intronic
984156348 4:176199958-176199980 CAGTAAAGACACTTCAGGCCAGG + Intergenic
984811562 4:183799873-183799895 CAGCAGAGACAGCTCAGGCCAGG - Intergenic
987130395 5:14854824-14854846 CCAGAGAGACAGCTGTGGCCTGG - Intronic
988603484 5:32660882-32660904 CAGTATAGGAAGTTCTGGCCAGG - Intergenic
990566327 5:57033037-57033059 TAGTAGAGACAGGTTTGGCCAGG - Intergenic
990901328 5:60752759-60752781 TAGTAGAGACAGGGTTGGCCAGG - Exonic
991223953 5:64247241-64247263 CAGTATTGGAAGTTGTGGCCAGG + Intronic
991437054 5:66607642-66607664 CAGTAGTGAAAGTATTGGCCTGG + Intronic
993050785 5:82923586-82923608 CAGGAGAGTCACTTGAGGCCAGG - Intergenic
997596762 5:135112226-135112248 GAGCAGAGACAGATGTGGCTGGG + Intronic
998229838 5:140353940-140353962 CAGGAGAATCACTTGTGGCCAGG - Intergenic
999882538 5:155882372-155882394 CATTAGGAACATTTGTGGCCAGG - Intronic
999995741 5:157090608-157090630 CAGGAGAGTCACTTGAGGCCAGG - Intronic
1001750744 5:174129245-174129267 TAGTAGAGACAGGAGTGGACTGG + Intronic
1001903512 5:175451745-175451767 CCGTAATGACAGGTGTGGCCAGG - Intergenic
1002308718 5:178300257-178300279 CAGTAGAGACCATCTTGGCCGGG + Intronic
1005330972 6:24750040-24750062 TAGTAGAGACAGGGTTGGCCAGG - Intergenic
1005785174 6:29237563-29237585 CTGTAAAGACACATGTGGCCAGG - Intergenic
1008207752 6:48684094-48684116 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1008762526 6:54869886-54869908 CAGTAGAGACATTAATGGCTGGG + Intronic
1011066082 6:83327464-83327486 CATAAGAGACAGGTGTGCCCCGG - Intronic
1011296264 6:85829531-85829553 CAGCAGGGACAGTTGTGGGGTGG - Intergenic
1012590639 6:100975815-100975837 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1012685205 6:102238617-102238639 CAATAAAGATAGTTTTGGCCAGG + Intergenic
1013181681 6:107721710-107721732 CAGGAGAGACAACTGTGGCCTGG + Intronic
1014175367 6:118325918-118325940 CGGCAGAAGCAGTTGTGGCCAGG - Intergenic
1017089019 6:150742270-150742292 CAGGAGAGAACGTGGTGGCCAGG + Intronic
1018865740 6:167745863-167745885 CCTCAGAGACAGTTGTGTCCTGG - Intergenic
1019205690 6:170359732-170359754 TAGTATTGAAAGTTGTGGCCGGG - Intronic
1021140681 7:17020820-17020842 TAATAGAGACAGATTTGGCCAGG - Intergenic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1021721804 7:23511654-23511676 CAGGAGGAACAGTTGAGGCCAGG + Intronic
1022168190 7:27794397-27794419 CAGTAGAGGCAGAAGTGGCTGGG - Exonic
1022493304 7:30837244-30837266 CAGAAGAGGCTGCTGTGGCCAGG - Intronic
1023942455 7:44778466-44778488 AAATAAAGACAGTTTTGGCCGGG + Intergenic
1024628709 7:51230287-51230309 CAGGAGAGGCAGTGGTGCCCCGG - Intronic
1025213488 7:57035333-57035355 CAGTAGGGTCATTTGAGGCCAGG + Intergenic
1025637274 7:63333581-63333603 CAGTAGAATCACTTGAGGCCAGG + Intergenic
1025645421 7:63414518-63414540 CAGTAGAATCACTTGAGGCCAGG - Intergenic
1025658465 7:63541490-63541512 CAGTAGGGTCATTTGAGGCCAGG - Intergenic
1027698629 7:81441151-81441173 CAGTGGAGACAGTGGTTGACAGG + Intergenic
1027988056 7:85320431-85320453 TAGTAGAGACTGTGTTGGCCAGG + Intergenic
1028519015 7:91708085-91708107 CAGTAGTGGCAGTGGTGGGCTGG - Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1030482709 7:110124243-110124265 CAGTATTGAAAGTTTTGGCCAGG + Intergenic
1031094684 7:117404150-117404172 CAGTACAAACAGTGATGGCCAGG - Intronic
1031799452 7:126223860-126223882 CAGTGGAGAGGGTTGTAGCCTGG - Intergenic
1032312915 7:130804934-130804956 AAGTAGAGACAGTTGTAGAAAGG + Intergenic
1033360684 7:140637039-140637061 TAGTAGAGACAGGGTTGGCCAGG + Intronic
1033823430 7:145161092-145161114 CAGCAGAAACACTTCTGGCCTGG - Intergenic
1034548619 7:151806005-151806027 TAGTAGAGACAGGTTTGGCCAGG - Intronic
1034919549 7:155068818-155068840 CAATACAGACAGCTGTGGCCTGG + Exonic
1035665752 8:1378487-1378509 CAGGAAAGACAGGTGAGGCCAGG - Intergenic
1035665770 8:1378603-1378625 CAGGACAGACAGGTGAGGCCAGG - Intergenic
1036740728 8:11359015-11359037 CAGAAGAGAGAGTCGTGGGCAGG + Intergenic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1037805254 8:22055161-22055183 CAGGAAGGACAGCTGTGGCCAGG - Intronic
1039180619 8:34861941-34861963 CAGCAGGGACACTTGAGGCCAGG + Intergenic
1040355571 8:46614835-46614857 ATGCAGAGACAGATGTGGCCTGG - Intergenic
1041318877 8:56593432-56593454 CAGGAGAGACAGGTATGGACAGG + Intergenic
1041539788 8:58970626-58970648 CAGTAGAAAGAGATGTGGGCTGG - Intronic
1041779489 8:61561694-61561716 CAGGAGGGTCACTTGTGGCCAGG + Intronic
1043477925 8:80622954-80622976 TAGTAGAGACAGAGTTGGCCAGG - Intergenic
1045287227 8:100802720-100802742 TAGTAGAGACAGGTTTTGCCAGG + Intergenic
1046482932 8:114846858-114846880 TAGCAGACACTGTTGTGGCCTGG - Intergenic
1047044846 8:121040932-121040954 AAGAAAAGTCAGTTGTGGCCAGG - Intergenic
1047205328 8:122798599-122798621 TAGTAGAGACAAGTTTGGCCAGG - Intronic
1050173627 9:2847691-2847713 TAGTAGAGACGGTGTTGGCCAGG + Intergenic
1051500707 9:17774299-17774321 CAGTACTGAAAGTTCTGGCCAGG - Intronic
1052409077 9:28099571-28099593 AAGTAGATACAGTGGTGGCTTGG - Intronic
1053689559 9:40576961-40576983 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054274471 9:63054096-63054118 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1054300805 9:63377900-63377922 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054400353 9:64710833-64710855 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054433944 9:65195091-65195113 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054496443 9:65826579-65826601 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1054917499 9:70509078-70509100 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
1055435814 9:76291030-76291052 CAGTAGAAACAGTGCTGGCCTGG - Intronic
1059231991 9:112729103-112729125 TTGTACAGACATTTGTGGCCAGG - Intergenic
1060976640 9:127768806-127768828 CAGTAGAGACCACTGTGGCCGGG - Intronic
1061260257 9:129476510-129476532 CAGTAGAGACGGGGTTGGCCAGG + Intergenic
1061365075 9:130168459-130168481 CAGGAGAGACATTTGGGGGCTGG - Intergenic
1061365082 9:130168486-130168508 CAGGAGAGACATTTGGGGGCTGG - Intergenic
1062477360 9:136735334-136735356 CAGCAGAGACAGCTGCGGCCGGG - Intergenic
1185633062 X:1530002-1530024 CACTATAGACATTTGGGGCCGGG - Intronic
1185644905 X:1609582-1609604 CAGTAGGAACAGGGGTGGCCTGG - Intergenic
1185644993 X:1609893-1609915 CAGTAGGGACAGGGGTGGCCTGG - Intergenic
1186732032 X:12420317-12420339 TAGTAGAGACAATGGAGGCCCGG - Intronic
1186968863 X:14818222-14818244 CAGTAGGGAGAGTGGTGCCCTGG + Intergenic
1187998562 X:24956064-24956086 CAGAAGAGTCATTTGAGGCCAGG + Intronic
1188960438 X:36484766-36484788 CAGTAGATACAAATGTTGCCAGG + Intergenic
1190756266 X:53404674-53404696 TAGTAGAGACAGGTTTGGCCAGG + Intronic
1192404141 X:70867001-70867023 CAGTATTGAAAGTTCTGGCCAGG + Intronic
1194252224 X:91589963-91589985 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1194640561 X:96399111-96399133 TAGTAGAGACAGGGTTGGCCAGG - Intergenic
1196238112 X:113306531-113306553 CAGAAGAGACAGGTATGCCCCGG + Intergenic
1196320228 X:114278806-114278828 TAGTAGAGACAGGGTTGGCCAGG + Intergenic
1197107603 X:122734186-122734208 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1198526022 X:137501841-137501863 GAGAAGAAAGAGTTGTGGCCTGG - Intergenic
1199350179 X:146790829-146790851 CAGCAGTGACAGTTGTGGGCTGG - Intergenic
1200571152 Y:4831203-4831225 CAGTATTGAAAGTTCTGGCCAGG + Intergenic
1201186133 Y:11404711-11404733 CAGTGTTGAAAGTTGTGGCCAGG - Intergenic
1201263650 Y:12184956-12184978 CAGTGTTGACAGTTCTGGCCAGG + Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic