ID: 940726418

View in Genome Browser
Species Human (GRCh38)
Location 2:157341478-157341500
Sequence GTTCCCACACAGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940726408_940726418 21 Left 940726408 2:157341434-157341456 CCAGGGGCTCTGGGAGTGGCTGC 0: 499
1: 274
2: 95
3: 106
4: 556
Right 940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG No data
940726406_940726418 29 Left 940726406 2:157341426-157341448 CCAGAGTTCCAGGGGCTCTGGGA 0: 529
1: 253
2: 94
3: 53
4: 356
Right 940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG No data
940726413_940726418 -1 Left 940726413 2:157341456-157341478 CCGGGTGAGCTGGTTCCAGTGGG No data
Right 940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940726418 Original CRISPR GTTCCCACACAGATGGGACA TGG Intergenic
No off target data available for this crispr