ID: 940726788

View in Genome Browser
Species Human (GRCh38)
Location 2:157343877-157343899
Sequence ACCTTTCACTGCTATTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940726788_940726791 14 Left 940726788 2:157343877-157343899 CCCCATGAATAGCAGTGAAAGGT No data
Right 940726791 2:157343914-157343936 ATGTGCTTTCTTATACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940726788 Original CRISPR ACCTTTCACTGCTATTCATG GGG (reversed) Intergenic
No off target data available for this crispr