ID: 940726789

View in Genome Browser
Species Human (GRCh38)
Location 2:157343878-157343900
Sequence AACCTTTCACTGCTATTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940726789_940726791 13 Left 940726789 2:157343878-157343900 CCCATGAATAGCAGTGAAAGGTT No data
Right 940726791 2:157343914-157343936 ATGTGCTTTCTTATACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940726789 Original CRISPR AACCTTTCACTGCTATTCAT GGG (reversed) Intergenic
No off target data available for this crispr