ID: 940726791

View in Genome Browser
Species Human (GRCh38)
Location 2:157343914-157343936
Sequence ATGTGCTTTCTTATACACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940726788_940726791 14 Left 940726788 2:157343877-157343899 CCCCATGAATAGCAGTGAAAGGT No data
Right 940726791 2:157343914-157343936 ATGTGCTTTCTTATACACCATGG No data
940726789_940726791 13 Left 940726789 2:157343878-157343900 CCCATGAATAGCAGTGAAAGGTT No data
Right 940726791 2:157343914-157343936 ATGTGCTTTCTTATACACCATGG No data
940726790_940726791 12 Left 940726790 2:157343879-157343901 CCATGAATAGCAGTGAAAGGTTA No data
Right 940726791 2:157343914-157343936 ATGTGCTTTCTTATACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940726791 Original CRISPR ATGTGCTTTCTTATACACCA TGG Intergenic
No off target data available for this crispr