ID: 940728305

View in Genome Browser
Species Human (GRCh38)
Location 2:157361030-157361052
Sequence GACTCACAGTTCCACGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940728305_940728308 17 Left 940728305 2:157361030-157361052 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 940728308 2:157361070-157361092 TTAGAAATTATACAATCTCAGGG No data
940728305_940728309 18 Left 940728305 2:157361030-157361052 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 940728309 2:157361071-157361093 TAGAAATTATACAATCTCAGGGG No data
940728305_940728307 16 Left 940728305 2:157361030-157361052 CCAGTCACGTGGAACTGTGAGTC 0: 36
1: 862
2: 5111
3: 8006
4: 8083
Right 940728307 2:157361069-157361091 TTTAGAAATTATACAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940728305 Original CRISPR GACTCACAGTTCCACGTGAC TGG (reversed) Intergenic
Too many off-targets to display for this crispr