ID: 940729766

View in Genome Browser
Species Human (GRCh38)
Location 2:157375479-157375501
Sequence CCTGCTAGGCGGTGCCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940729760_940729766 2 Left 940729760 2:157375454-157375476 CCCAAGGTCTTGGGCAGTTTCAT No data
Right 940729766 2:157375479-157375501 CCTGCTAGGCGGTGCCCTCATGG No data
940729761_940729766 1 Left 940729761 2:157375455-157375477 CCAAGGTCTTGGGCAGTTTCATG No data
Right 940729766 2:157375479-157375501 CCTGCTAGGCGGTGCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940729766 Original CRISPR CCTGCTAGGCGGTGCCCTCA TGG Intergenic
No off target data available for this crispr