ID: 940734278

View in Genome Browser
Species Human (GRCh38)
Location 2:157431362-157431384
Sequence GAAATTGTACACATGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940734276_940734278 6 Left 940734276 2:157431333-157431355 CCAAGCTAAAACACTCATTATAG No data
Right 940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG No data
940734275_940734278 7 Left 940734275 2:157431332-157431354 CCCAAGCTAAAACACTCATTATA No data
Right 940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG No data
940734273_940734278 21 Left 940734273 2:157431318-157431340 CCCTAAGTGGTTCTCCCAAGCTA No data
Right 940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG No data
940734274_940734278 20 Left 940734274 2:157431319-157431341 CCTAAGTGGTTCTCCCAAGCTAA No data
Right 940734278 2:157431362-157431384 GAAATTGTACACATGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940734278 Original CRISPR GAAATTGTACACATGCAGCA AGG Intronic
No off target data available for this crispr