ID: 940734318

View in Genome Browser
Species Human (GRCh38)
Location 2:157431966-157431988
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940734314_940734318 18 Left 940734314 2:157431925-157431947 CCTCTAAAGGACTTCTATCTAAT No data
Right 940734318 2:157431966-157431988 CCCCATATCTTAAAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr