ID: 940736042

View in Genome Browser
Species Human (GRCh38)
Location 2:157453633-157453655
Sequence TAGAACATGCAGGACCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940736042_940736045 6 Left 940736042 2:157453633-157453655 CCTTCAAGGTCCTGCATGTTCTA No data
Right 940736045 2:157453662-157453684 CCTACAACTTCATATCACCCTGG No data
940736042_940736046 15 Left 940736042 2:157453633-157453655 CCTTCAAGGTCCTGCATGTTCTA No data
Right 940736046 2:157453671-157453693 TCATATCACCCTGGTCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940736042 Original CRISPR TAGAACATGCAGGACCTTGA AGG (reversed) Intronic
No off target data available for this crispr