ID: 940737360

View in Genome Browser
Species Human (GRCh38)
Location 2:157468420-157468442
Sequence AACCCAGGACTACTCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940737360_940737365 30 Left 940737360 2:157468420-157468442 CCTCTGTGGAGTAGTCCTGGGTT No data
Right 940737365 2:157468473-157468495 CTCTTTGTATGTTCTAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940737360 Original CRISPR AACCCAGGACTACTCCACAG AGG (reversed) Intronic
No off target data available for this crispr