ID: 940737445

View in Genome Browser
Species Human (GRCh38)
Location 2:157469379-157469401
Sequence ATCTAGTTCTAGAAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940737444_940737445 6 Left 940737444 2:157469350-157469372 CCATGTTCTAAAAAGTTTGCAAA No data
Right 940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG No data
940737439_940737445 28 Left 940737439 2:157469328-157469350 CCTTCTTCTCCCCCAAAGTGTTC No data
Right 940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG No data
940737441_940737445 18 Left 940737441 2:157469338-157469360 CCCCAAAGTGTTCCATGTTCTAA No data
Right 940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG No data
940737442_940737445 17 Left 940737442 2:157469339-157469361 CCCAAAGTGTTCCATGTTCTAAA No data
Right 940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG No data
940737443_940737445 16 Left 940737443 2:157469340-157469362 CCAAAGTGTTCCATGTTCTAAAA No data
Right 940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG No data
940737440_940737445 19 Left 940737440 2:157469337-157469359 CCCCCAAAGTGTTCCATGTTCTA No data
Right 940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940737445 Original CRISPR ATCTAGTTCTAGAAGTATGA AGG Intronic
No off target data available for this crispr