ID: 940740358

View in Genome Browser
Species Human (GRCh38)
Location 2:157500616-157500638
Sequence CTACATGGCAATTATCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940740358_940740361 6 Left 940740358 2:157500616-157500638 CCTATTTGATAATTGCCATGTAG No data
Right 940740361 2:157500645-157500667 AGTAGAATATTCTTATGTTTAGG No data
940740358_940740363 26 Left 940740358 2:157500616-157500638 CCTATTTGATAATTGCCATGTAG No data
Right 940740363 2:157500665-157500687 AGGAGATGCATACTGAAGTAGGG No data
940740358_940740362 25 Left 940740358 2:157500616-157500638 CCTATTTGATAATTGCCATGTAG No data
Right 940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940740358 Original CRISPR CTACATGGCAATTATCAAAT AGG (reversed) Intergenic
No off target data available for this crispr