ID: 940740359

View in Genome Browser
Species Human (GRCh38)
Location 2:157500631-157500653
Sequence TATTCTACTGGATAACTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940740359_940740361 -9 Left 940740359 2:157500631-157500653 CCATGTAGTTATCCAGTAGAATA No data
Right 940740361 2:157500645-157500667 AGTAGAATATTCTTATGTTTAGG No data
940740359_940740363 11 Left 940740359 2:157500631-157500653 CCATGTAGTTATCCAGTAGAATA No data
Right 940740363 2:157500665-157500687 AGGAGATGCATACTGAAGTAGGG No data
940740359_940740362 10 Left 940740359 2:157500631-157500653 CCATGTAGTTATCCAGTAGAATA No data
Right 940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940740359 Original CRISPR TATTCTACTGGATAACTACA TGG (reversed) Intergenic
No off target data available for this crispr