ID: 940740360 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:157500643-157500665 |
| Sequence | TAAACATAAGAATATTCTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940740360_940740362 | -2 | Left | 940740360 | 2:157500643-157500665 | CCAGTAGAATATTCTTATGTTTA | No data | ||
| Right | 940740362 | 2:157500664-157500686 | TAGGAGATGCATACTGAAGTAGG | No data | ||||
| 940740360_940740363 | -1 | Left | 940740360 | 2:157500643-157500665 | CCAGTAGAATATTCTTATGTTTA | No data | ||
| Right | 940740363 | 2:157500665-157500687 | AGGAGATGCATACTGAAGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940740360 | Original CRISPR | TAAACATAAGAATATTCTAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||