ID: 940740360

View in Genome Browser
Species Human (GRCh38)
Location 2:157500643-157500665
Sequence TAAACATAAGAATATTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940740360_940740362 -2 Left 940740360 2:157500643-157500665 CCAGTAGAATATTCTTATGTTTA No data
Right 940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG No data
940740360_940740363 -1 Left 940740360 2:157500643-157500665 CCAGTAGAATATTCTTATGTTTA No data
Right 940740363 2:157500665-157500687 AGGAGATGCATACTGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940740360 Original CRISPR TAAACATAAGAATATTCTAC TGG (reversed) Intergenic
No off target data available for this crispr