ID: 940740361

View in Genome Browser
Species Human (GRCh38)
Location 2:157500645-157500667
Sequence AGTAGAATATTCTTATGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940740358_940740361 6 Left 940740358 2:157500616-157500638 CCTATTTGATAATTGCCATGTAG No data
Right 940740361 2:157500645-157500667 AGTAGAATATTCTTATGTTTAGG No data
940740359_940740361 -9 Left 940740359 2:157500631-157500653 CCATGTAGTTATCCAGTAGAATA No data
Right 940740361 2:157500645-157500667 AGTAGAATATTCTTATGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940740361 Original CRISPR AGTAGAATATTCTTATGTTT AGG Intergenic
No off target data available for this crispr