ID: 940740362

View in Genome Browser
Species Human (GRCh38)
Location 2:157500664-157500686
Sequence TAGGAGATGCATACTGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940740360_940740362 -2 Left 940740360 2:157500643-157500665 CCAGTAGAATATTCTTATGTTTA No data
Right 940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG No data
940740359_940740362 10 Left 940740359 2:157500631-157500653 CCATGTAGTTATCCAGTAGAATA No data
Right 940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG No data
940740358_940740362 25 Left 940740358 2:157500616-157500638 CCTATTTGATAATTGCCATGTAG No data
Right 940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940740362 Original CRISPR TAGGAGATGCATACTGAAGT AGG Intergenic
No off target data available for this crispr