ID: 940740363

View in Genome Browser
Species Human (GRCh38)
Location 2:157500665-157500687
Sequence AGGAGATGCATACTGAAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940740359_940740363 11 Left 940740359 2:157500631-157500653 CCATGTAGTTATCCAGTAGAATA No data
Right 940740363 2:157500665-157500687 AGGAGATGCATACTGAAGTAGGG No data
940740360_940740363 -1 Left 940740360 2:157500643-157500665 CCAGTAGAATATTCTTATGTTTA No data
Right 940740363 2:157500665-157500687 AGGAGATGCATACTGAAGTAGGG No data
940740358_940740363 26 Left 940740358 2:157500616-157500638 CCTATTTGATAATTGCCATGTAG No data
Right 940740363 2:157500665-157500687 AGGAGATGCATACTGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940740363 Original CRISPR AGGAGATGCATACTGAAGTA GGG Intergenic
No off target data available for this crispr