ID: 940741077

View in Genome Browser
Species Human (GRCh38)
Location 2:157508323-157508345
Sequence CTTAACATGAAGTATATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940741073_940741077 -4 Left 940741073 2:157508304-157508326 CCTTAATCCAAAGTATTGCCTTA No data
Right 940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG No data
940741070_940741077 25 Left 940741070 2:157508275-157508297 CCTCAAGTAAAATATACATTCCT No data
Right 940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG No data
940741072_940741077 -1 Left 940741072 2:157508301-157508323 CCACCTTAATCCAAAGTATTGCC No data
Right 940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG No data
940741068_940741077 30 Left 940741068 2:157508270-157508292 CCCTGCCTCAAGTAAAATATACA No data
Right 940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG No data
940741069_940741077 29 Left 940741069 2:157508271-157508293 CCTGCCTCAAGTAAAATATACAT No data
Right 940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG No data
940741071_940741077 5 Left 940741071 2:157508295-157508317 CCTCTTCCACCTTAATCCAAAGT No data
Right 940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940741077 Original CRISPR CTTAACATGAAGTATATGGA TGG Intergenic
No off target data available for this crispr