ID: 940748452

View in Genome Browser
Species Human (GRCh38)
Location 2:157597212-157597234
Sequence GGGCAGGTTAATGCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940748452_940748453 -8 Left 940748452 2:157597212-157597234 CCTGCATGTGCATTAACCTGCCC No data
Right 940748453 2:157597227-157597249 ACCTGCCCCCACTTTGTCAACGG No data
940748452_940748455 -7 Left 940748452 2:157597212-157597234 CCTGCATGTGCATTAACCTGCCC No data
Right 940748455 2:157597228-157597250 CCTGCCCCCACTTTGTCAACGGG No data
940748452_940748461 19 Left 940748452 2:157597212-157597234 CCTGCATGTGCATTAACCTGCCC No data
Right 940748461 2:157597254-157597276 GGTAACACTCACTGCCCTGATGG No data
940748452_940748458 -2 Left 940748452 2:157597212-157597234 CCTGCATGTGCATTAACCTGCCC No data
Right 940748458 2:157597233-157597255 CCCCACTTTGTCAACGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940748452 Original CRISPR GGGCAGGTTAATGCACATGC AGG (reversed) Intronic
No off target data available for this crispr