ID: 940749872

View in Genome Browser
Species Human (GRCh38)
Location 2:157613053-157613075
Sequence CCCCACTAGACTGTTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940749872_940749877 -6 Left 940749872 2:157613053-157613075 CCCATGGCAACAGTCTAGTGGGG No data
Right 940749877 2:157613070-157613092 GTGGGGATGTGGACTGCTAAGGG No data
940749872_940749876 -7 Left 940749872 2:157613053-157613075 CCCATGGCAACAGTCTAGTGGGG No data
Right 940749876 2:157613069-157613091 AGTGGGGATGTGGACTGCTAAGG No data
940749872_940749878 23 Left 940749872 2:157613053-157613075 CCCATGGCAACAGTCTAGTGGGG No data
Right 940749878 2:157613099-157613121 ACTTACCCATTCCCTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940749872 Original CRISPR CCCCACTAGACTGTTGCCAT GGG (reversed) Intronic
No off target data available for this crispr