ID: 940754458

View in Genome Browser
Species Human (GRCh38)
Location 2:157666229-157666251
Sequence AGTATCAATGAAGATATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940754456_940754458 3 Left 940754456 2:157666203-157666225 CCTTTATAATTAATACAGTAAGC No data
Right 940754458 2:157666229-157666251 AGTATCAATGAAGATATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940754458 Original CRISPR AGTATCAATGAAGATATGGA AGG Intergenic
No off target data available for this crispr