ID: 940756259

View in Genome Browser
Species Human (GRCh38)
Location 2:157686540-157686562
Sequence CTAGTACAATACCTATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940756259_940756262 22 Left 940756259 2:157686540-157686562 CCAAGAAATAGGTATTGTACTAG No data
Right 940756262 2:157686585-157686607 CAAAACAGTCCCTGCCCTCATGG No data
940756259_940756264 24 Left 940756259 2:157686540-157686562 CCAAGAAATAGGTATTGTACTAG No data
Right 940756264 2:157686587-157686609 AAACAGTCCCTGCCCTCATGGGG No data
940756259_940756263 23 Left 940756259 2:157686540-157686562 CCAAGAAATAGGTATTGTACTAG No data
Right 940756263 2:157686586-157686608 AAAACAGTCCCTGCCCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940756259 Original CRISPR CTAGTACAATACCTATTTCT TGG (reversed) Intergenic
No off target data available for this crispr