ID: 940762097

View in Genome Browser
Species Human (GRCh38)
Location 2:157749909-157749931
Sequence CGCCCAGTGCTGCCCCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940762085_940762097 23 Left 940762085 2:157749863-157749885 CCTGCACCCATGTGCACCAATGG No data
Right 940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG No data
940762090_940762097 16 Left 940762090 2:157749870-157749892 CCATGTGCACCAATGGGAGGCCT No data
Right 940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG No data
940762089_940762097 17 Left 940762089 2:157749869-157749891 CCCATGTGCACCAATGGGAGGCC No data
Right 940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG No data
940762094_940762097 -4 Left 940762094 2:157749890-157749912 CCTGAGGACAGGTTCATCCCGCC No data
Right 940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG No data
940762084_940762097 29 Left 940762084 2:157749857-157749879 CCACAGCCTGCACCCATGTGCAC No data
Right 940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG No data
940762092_940762097 7 Left 940762092 2:157749879-157749901 CCAATGGGAGGCCTGAGGACAGG No data
Right 940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940762097 Original CRISPR CGCCCAGTGCTGCCCCTGTC AGG Intronic
No off target data available for this crispr