ID: 940764759

View in Genome Browser
Species Human (GRCh38)
Location 2:157778300-157778322
Sequence CAGAATTTCCACTTGGAGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 179}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940764759_940764769 11 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764769 2:157778334-157778356 AGGATTTTCCTGGAGTTGGAGGG 0: 1
1: 1
2: 2
3: 31
4: 228
940764759_940764768 10 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764768 2:157778333-157778355 AAGGATTTTCCTGGAGTTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 248
940764759_940764773 19 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764773 2:157778342-157778364 CCTGGAGTTGGAGGGAAAAGGGG 0: 1
1: 2
2: 3
3: 62
4: 540
940764759_940764771 18 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764771 2:157778341-157778363 TCCTGGAGTTGGAGGGAAAAGGG 0: 1
1: 1
2: 2
3: 34
4: 468
940764759_940764774 20 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764774 2:157778343-157778365 CTGGAGTTGGAGGGAAAAGGGGG 0: 1
1: 0
2: 8
3: 72
4: 617
940764759_940764767 7 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764767 2:157778330-157778352 GGGAAGGATTTTCCTGGAGTTGG 0: 1
1: 0
2: 2
3: 23
4: 266
940764759_940764764 -9 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764764 2:157778314-157778336 GAAATTCTGTGTTCCAGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 269
940764759_940764765 1 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764765 2:157778324-157778346 GTTCCAGGGAAGGATTTTCCTGG 0: 1
1: 0
2: 4
3: 18
4: 232
940764759_940764770 17 Left 940764759 2:157778300-157778322 CCAACCTCCAAGTGGAAATTCTG 0: 1
1: 0
2: 1
3: 9
4: 179
Right 940764770 2:157778340-157778362 TTCCTGGAGTTGGAGGGAAAAGG 0: 1
1: 0
2: 4
3: 68
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940764759 Original CRISPR CAGAATTTCCACTTGGAGGT TGG (reversed) Exonic
900586870 1:3436905-3436927 CGGAATTTCCATTTGGGGGATGG - Exonic
904326985 1:29732944-29732966 CAGAAATGCCTCTTAGAGGTTGG - Intergenic
904742120 1:32685957-32685979 CAGAGGTTCAAGTTGGAGGTAGG - Exonic
909629093 1:77752033-77752055 CAGAATTTCAACCTGGAATTTGG - Intronic
911407662 1:97463009-97463031 GAGATTTTCCAATTGGAAGTTGG - Intronic
911771100 1:101743728-101743750 CAGAACTTACACTAGGAGCTGGG - Intergenic
912600352 1:110925264-110925286 CAGAATTCCCTCTTTGAGGAAGG - Intergenic
912664755 1:111569104-111569126 CAAAAGTTACACTTGGAGGCCGG + Intronic
913231659 1:116745094-116745116 GAGAAGTACCACTTGGAGGAGGG + Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
914434146 1:147645383-147645405 AAGAATTTCCAGTTTGAGGCCGG - Exonic
914802796 1:150973449-150973471 CAGATTTTCCCCTGGGAGGAAGG - Intronic
917855236 1:179094185-179094207 CACAATCTCCGCCTGGAGGTGGG - Exonic
917860273 1:179136962-179136984 CAGAAATTCCTGTTGTAGGTTGG + Intronic
918187188 1:182138503-182138525 TAGAATTTCCACTGGGAAATAGG - Intergenic
919655911 1:200196972-200196994 CAGAATTTCCTCATAGAGGAAGG - Intergenic
919946239 1:202320860-202320882 CAGAATTTCCACTAGGCATTGGG - Intergenic
921117110 1:212102854-212102876 CAGATTTTCCTCATGGAGCTGGG - Exonic
1064237496 10:13589135-13589157 CTTAATTTCCACTTGGAAGCTGG + Intronic
1065709365 10:28500681-28500703 CAGTATTTCCACTGAGAGCTAGG + Intergenic
1065741130 10:28798102-28798124 CAGAATTTCCTTTTTGAGGCTGG + Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1069708355 10:70473378-70473400 GAGCATTTCCACATGGAGCTTGG + Intergenic
1071387091 10:85132382-85132404 AGGAATTCCCACTTGGAGGCGGG + Intergenic
1072394857 10:95028080-95028102 AAGCATTTCCACTTATAGGTGGG - Intergenic
1072462481 10:95632456-95632478 CAGAAGGTTCACTTGGAGCTGGG - Intronic
1076572775 10:131443589-131443611 CTGAATTTCTCCTTGGAGGCTGG + Intergenic
1077598408 11:3554564-3554586 CAGAAGTGTCATTTGGAGGTAGG + Intergenic
1079918271 11:26398710-26398732 CAGAACTTCCTCGTGGAGGCAGG + Intronic
1080287900 11:30637937-30637959 CAGGATTCCAACTTGGGGGTAGG - Intergenic
1080973149 11:37303058-37303080 CAGAATTCCTACTTGGTGGCTGG - Intergenic
1081236954 11:40657971-40657993 CAGACTTTTCACATGGAAGTAGG + Intronic
1083279577 11:61618534-61618556 CAGACTGTGCACTTTGAGGTGGG + Intergenic
1084254487 11:67930440-67930462 CAGAAATGTCATTTGGAGGTAGG + Intergenic
1084818378 11:71665443-71665465 CAGAAATGTCATTTGGAGGTAGG - Intergenic
1085437564 11:76522098-76522120 CAGAATTTACAACTGAAGGTTGG + Intronic
1087564205 11:99833692-99833714 TAGAAACTCCACTTGGAGATAGG + Intronic
1088631709 11:111779848-111779870 GGGAATTTCCAGTTGTAGGTTGG - Intergenic
1088968492 11:114750003-114750025 AAGAATGTCCTCTTGGAGGAGGG - Intergenic
1090760534 11:129833338-129833360 CAACATATACACTTGGAGGTGGG - Intronic
1091926294 12:4353448-4353470 AAGAATTTCCAGTTTGAGGAAGG + Exonic
1092506802 12:9109983-9110005 CAGAGTTTCCAGTTAGAGGGTGG - Exonic
1094126824 12:27032277-27032299 CTGAATTTCAACTTGGGGGCTGG + Intronic
1094419195 12:30252889-30252911 CAGAATTGGCACTTGGAGAAAGG - Intergenic
1094428902 12:30344839-30344861 CAAAATTGGCACTTGGAGGAAGG + Intergenic
1096320702 12:50610446-50610468 CTGAAGTTTCACTTGGAGGAGGG - Intronic
1097397590 12:59094576-59094598 CAGAATTTAGTCTTGGCGGTGGG + Intergenic
1100707244 12:97214627-97214649 CAGAATGTCTTCTTGGAGGAAGG - Intergenic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1103047742 12:117751731-117751753 CCAAACTGCCACTTGGAGGTAGG + Intronic
1105553894 13:21427424-21427446 CAGATTTTCTACTTGGAGGAGGG - Intronic
1110788649 13:79562347-79562369 TAGAATTTCCACTGAGAGGTTGG - Intergenic
1112620645 13:101050744-101050766 CAGAAGTTCAACTTTGAGGTTGG + Intergenic
1113399168 13:109975592-109975614 CAGAATTAGCAGTTGGTGGTGGG + Intergenic
1118576281 14:67244262-67244284 CAGCAATTCCACTTATAGGTAGG - Intronic
1119095368 14:71825032-71825054 CTGACTTGCCACCTGGAGGTCGG - Intergenic
1124924457 15:34057583-34057605 CAGATTTTAAACTTTGAGGTGGG - Intronic
1128413364 15:67421330-67421352 CAGCATGTCCACTGTGAGGTTGG - Exonic
1128688211 15:69702954-69702976 CATGATTTCCATTTGGAGGATGG + Intergenic
1129600596 15:76996123-76996145 CAGAATTACCATTTGGAGTGAGG - Intronic
1138337868 16:56267214-56267236 CAGCATACCTACTTGGAGGTGGG - Intronic
1138717873 16:59044956-59044978 CAAAATTTCCCCTTGGAAATTGG - Intergenic
1139305704 16:65984317-65984339 AAGAAAGTCCATTTGGAGGTGGG - Intergenic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1145876983 17:28326412-28326434 CCGAGTTTCCACTTGGAGAAGGG + Intronic
1146654629 17:34627804-34627826 CAGCATTTAAACTTGAAGGTAGG - Intronic
1148553680 17:48565178-48565200 CAGAATTTCATCATGGGGGTGGG - Intronic
1148712434 17:49691619-49691641 ATGAATTTCCATTTGGAGATGGG - Intergenic
1149729025 17:58925992-58926014 CACAATTCCCAGTTGGAGGAGGG - Intronic
1150644043 17:66967067-66967089 CAGAATTTCCACTGGGAAACTGG - Intronic
1152022617 17:77788581-77788603 CAGAATGACCACGTGGATGTGGG + Intergenic
1153128837 18:1831046-1831068 CAAAATTTTCTCTTGGAGTTAGG - Intergenic
1157376612 18:47173315-47173337 CAGAATTTACTCTTGGACTTTGG - Intronic
1162558077 19:11400028-11400050 CAGAATGCTCACCTGGAGGTGGG + Exonic
1165117987 19:33540636-33540658 CAGATCTTCCTCTGGGAGGTGGG - Intergenic
1167049668 19:47070753-47070775 CAAAATTTCCACATGGCCGTCGG + Intronic
925256978 2:2498796-2498818 CAGAATTTCCACATGTGGGAGGG - Intergenic
925786840 2:7439845-7439867 CAGAATTTCCCCTTGATGATGGG + Intergenic
928634803 2:33233640-33233662 GGAAATTTCCACTTGGAGTTTGG + Intronic
931376794 2:61715263-61715285 CAGAAGTTCCACTTAGTGGTGGG + Intergenic
936958888 2:118052303-118052325 CACAATTATCACTTGGAGATAGG - Intergenic
940146985 2:150555799-150555821 CAGATTTTCCACTTGCAGAAAGG + Intergenic
940764759 2:157778300-157778322 CAGAATTTCCACTTGGAGGTTGG - Exonic
941493858 2:166176483-166176505 CAGAATTGACATTTGGAAGTAGG + Intergenic
941850302 2:170173529-170173551 CAGAATTTCCAGGGAGAGGTGGG + Intergenic
941963011 2:171272264-171272286 CACAATTTCCACTTGTAGATGGG - Intergenic
942807396 2:179948044-179948066 TAGCATTTCCACTTCCAGGTAGG + Intronic
943490585 2:188550289-188550311 CAGAATTTGAACTTAGAGGAAGG + Intronic
945963316 2:216158801-216158823 ATGAATTTCCTCTTAGAGGTAGG - Intronic
948354044 2:237362906-237362928 CACAGTTTCCAATTGGAGGATGG + Intronic
1168813279 20:720116-720138 CAGAGTCTCCAGCTGGAGGTTGG + Intergenic
1170119017 20:12892338-12892360 CAGTCTTTCCCCTTGTAGGTGGG - Intergenic
1170951911 20:20944542-20944564 AAATATTTCCACTTGGAGGCAGG - Intergenic
1171285628 20:23936192-23936214 GGGAATTTCCATTTGCAGGTTGG - Intergenic
1171366510 20:24628538-24628560 CAGAATTTCCACTTCAAGAAAGG + Intronic
1172203227 20:33141551-33141573 CTGAAATTCTAGTTGGAGGTTGG - Intergenic
1172249072 20:33466106-33466128 CAGCAATTCCACTTCTAGGTGGG + Intergenic
1172656091 20:36539403-36539425 CAGAATTTCTTTTTGGGGGTGGG - Intergenic
1172992298 20:39045576-39045598 CAGAATATGAGCTTGGAGGTGGG - Intergenic
1173793379 20:45842135-45842157 CAAGAAGTCCACTTGGAGGTTGG - Intronic
1174690188 20:52496538-52496560 CAGAATTTCTGCTAAGAGGTAGG - Intergenic
1175793765 20:61758482-61758504 CAGAATTGCCACGAGGAGTTAGG + Intronic
1178621779 21:34183492-34183514 CAAATTTTCCACTAGGAGGAAGG + Intergenic
1179769298 21:43602606-43602628 CAGAAATGCCTCTTGGAGTTTGG - Intronic
1180940202 22:19655830-19655852 CTCAGTATCCACTTGGAGGTTGG - Intergenic
1180982127 22:19883539-19883561 CAGAATGTCCACTTAGAGACCGG + Intronic
1184753925 22:46505668-46505690 AGCAATTTGCACTTGGAGGTGGG + Intronic
1185375296 22:50480132-50480154 CAGAATTTCTACTTCCAGGAAGG + Intergenic
949893894 3:8754757-8754779 CAGAATTACCCTCTGGAGGTAGG + Intronic
950721063 3:14882930-14882952 CAGAATTTCCTCTTAGAGATTGG + Intronic
951475849 3:23105263-23105285 CAGGATTTGCCCTTGGAGGCAGG + Intergenic
951679860 3:25283432-25283454 AAGAATTTCCACTTGGGGTCAGG - Intronic
953342956 3:42150941-42150963 TAGAATTTCCTTTTGGAGTTAGG - Intronic
953613730 3:44470661-44470683 CATGATTTCCTCTGGGAGGTGGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955941774 3:64152748-64152770 CATAGTCCCCACTTGGAGGTGGG + Intronic
957564681 3:81868687-81868709 GAGAATTTAAACTTGGAGATAGG + Intergenic
961284846 3:125793270-125793292 CAGAAATGTCATTTGGAGGTAGG - Intergenic
961369222 3:126419343-126419365 CAAGGCTTCCACTTGGAGGTTGG + Intronic
963659888 3:148112282-148112304 GAGAATGTGCACTTGGGGGTGGG + Intergenic
964109679 3:153075430-153075452 TAGAATTTGCATTTGGATGTGGG - Intergenic
965185669 3:165459842-165459864 TAAAATTTCCTATTGGAGGTCGG - Intergenic
965879887 3:173376073-173376095 CAGCATTTGAACTTGGATGTGGG - Intergenic
968083000 3:195859863-195859885 CAGAAACTGCATTTGGAGGTTGG - Intergenic
969740954 4:9026202-9026224 CAGAAATGCCATTTGGAAGTAGG - Intergenic
970936546 4:21577769-21577791 CAGAATTTCCAAATAGAGGAAGG - Intronic
973848639 4:54938775-54938797 CAGAACTTCCATTTGAATGTTGG - Intergenic
975565734 4:75752537-75752559 CAGAAATACCGCTTGGAAGTGGG + Exonic
976390244 4:84498641-84498663 CCGAATCTCCACTTTGAAGTTGG + Intergenic
977051899 4:92138544-92138566 CATAATTTCCACTTGTGGGAGGG - Intergenic
979936411 4:126702791-126702813 CAGAATGTCCACCTGAAGGTGGG + Intergenic
983032742 4:162823299-162823321 CTGCATATCCACTTAGAGGTTGG + Intergenic
984833993 4:184002101-184002123 CAGGATCTCCATTTGGGGGTGGG - Intronic
985706925 5:1406754-1406776 CAGAATTTCATTTTGGAGGATGG - Intronic
985976786 5:3425633-3425655 TAGAATTTCCATTGGGGGGTGGG + Intergenic
986301733 5:6482949-6482971 CAGTTTTCCCACTTGGAGCTGGG - Intronic
986468335 5:8049658-8049680 CAGAATTTGCAGTTTGAGGCTGG + Intergenic
987621839 5:20345219-20345241 CCCAATTTCCAATTGGATGTTGG - Intronic
988085217 5:26467410-26467432 CAGAATTACCATTTGGGGGTAGG + Intergenic
988430881 5:31117272-31117294 CATAATTTCCTGTTGGATGTGGG + Intergenic
989510615 5:42283158-42283180 TAGAATTCCCACTTGTAGGATGG + Intergenic
989846546 5:46151438-46151460 CCAAATTTCCATTTGCAGGTCGG - Intergenic
992858616 5:80889827-80889849 CAGAATATACACTTGAAGCTCGG - Intergenic
993041013 5:82814765-82814787 CAAAATTTCCATTTGGAAATGGG + Intergenic
993580138 5:89651551-89651573 CTAAATCTCCTCTTGGAGGTGGG + Intergenic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
994880425 5:105486693-105486715 CAGCTTTTCTACTTGGGGGTAGG + Intergenic
995381723 5:111542778-111542800 CAGAATTTCCTCTTGGGTTTTGG - Intergenic
1000127936 5:158265620-158265642 CAGCATTATCACCTGGAGGTGGG - Intergenic
1004381828 6:15139161-15139183 AAGAATTTTAACTTGGAAGTAGG - Intergenic
1004884022 6:20034844-20034866 CAGAATTTCCAAAAGGAGGGAGG + Intergenic
1005767442 6:29026873-29026895 CAGAATTACTACTGTGAGGTGGG + Intergenic
1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG + Intronic
1008334159 6:50280141-50280163 CACACTTTCCAAGTGGAGGTAGG - Intergenic
1008342504 6:50384633-50384655 CTAAATTTCCACTTGGACCTGGG + Intergenic
1011537161 6:88388619-88388641 CAGTAATTCCACTTTTAGGTGGG - Intergenic
1012399106 6:98830352-98830374 AAGAAGTTCCACTCAGAGGTTGG + Intergenic
1014302613 6:119701312-119701334 CAGAACTTACACTTGGAGGTAGG + Intergenic
1014766413 6:125411577-125411599 CAGAATTTCTAATGGGATGTGGG - Intergenic
1014819587 6:125972516-125972538 AATAATTTCCACTTGAAGTTTGG + Intronic
1016363675 6:143293538-143293560 GAGAATGTCCACTTGGGTGTTGG + Intronic
1016859847 6:148706616-148706638 AAGAATTTTGACTTGGAGGATGG - Intergenic
1017066972 6:150538057-150538079 CAGAAGATCCTCTTGGATGTTGG - Intergenic
1020127185 7:5539449-5539471 CAGAAATGCCCCTTGGAGCTGGG + Intronic
1024390689 7:48808499-48808521 GAGAAGTTCCACTTGGAGACTGG + Intergenic
1025781732 7:64608128-64608150 CACAATTTCCACTTGTGGGCTGG - Intergenic
1031519083 7:122740965-122740987 CAGCAATTCCACTTTGAGATTGG + Intronic
1031607734 7:123790059-123790081 CAGAATTTCTTCTTTGAGGCGGG + Intergenic
1033023712 7:137753073-137753095 CACAATACCCACTTGGAAGTTGG + Intronic
1033992923 7:147310058-147310080 CTGTTTTTCCACTTGGAGATTGG + Intronic
1035563606 8:627227-627249 CAGACTTCCCACCTGGAAGTTGG + Intronic
1036246157 8:7118793-7118815 CAGAAATGTCATTTGGAGGTAGG - Intergenic
1037836758 8:22219264-22219286 TAGAATTTCCACCTAGAGCTGGG - Intergenic
1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG + Intronic
1045416667 8:101974410-101974432 CAGAATTTCCACATAGAAGGGGG - Intronic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1047577014 8:126167492-126167514 CCGAATCTCCACTTGAAGATTGG - Intergenic
1047597775 8:126395924-126395946 CAGAATGTACATTTGGAAGTGGG - Intergenic
1048602652 8:135934571-135934593 CAGGACTTCCACTTGGAAATAGG - Intergenic
1055005886 9:71505617-71505639 CTGAATTTGAACTTGGAGGATGG + Intergenic
1055258404 9:74401646-74401668 CAGAATTTCCACTGGGGAATGGG - Intergenic
1058932855 9:109738951-109738973 CAGAATTTCCATTTGGCTCTTGG + Intronic
1186110721 X:6253055-6253077 CAGTATTTCAACTTGGTGCTGGG - Intergenic
1187677065 X:21726754-21726776 CAGAATTGCCTCTGGGAGTTAGG + Intronic
1188023295 X:25182216-25182238 CACAATTTCCACTTGCATGTGGG - Intergenic
1189100802 X:38187531-38187553 CATAGTTTACACTTTGAGGTAGG + Intronic
1193204882 X:78736638-78736660 TAGAATTGCCATTTGGAGCTAGG + Intergenic
1195803224 X:108735455-108735477 CAGTATTTCTTCTTGGAAGTAGG - Exonic
1199725885 X:150580343-150580365 CAGAATTTCCATCTGGATCTTGG + Intronic
1201074659 Y:10177970-10177992 CAGAATCACCAGTTGGGGGTTGG - Intergenic