ID: 940765416

View in Genome Browser
Species Human (GRCh38)
Location 2:157784805-157784827
Sequence TCGGAGGAGGTGTGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940765416_940765424 26 Left 940765416 2:157784805-157784827 CCACCTGGGCACACCTCCTCCGA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765416_940765422 6 Left 940765416 2:157784805-157784827 CCACCTGGGCACACCTCCTCCGA No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940765416 Original CRISPR TCGGAGGAGGTGTGCCCAGG TGG (reversed) Intronic