ID: 940765417 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:157784808-157784830 |
Sequence | GACTCGGAGGAGGTGTGCCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940765417_940765424 | 23 | Left | 940765417 | 2:157784808-157784830 | CCTGGGCACACCTCCTCCGAGTC | No data | ||
Right | 940765424 | 2:157784854-157784876 | AGGCAGACCAAAGAACATCGTGG | No data | ||||
940765417_940765422 | 3 | Left | 940765417 | 2:157784808-157784830 | CCTGGGCACACCTCCTCCGAGTC | No data | ||
Right | 940765422 | 2:157784834-157784856 | TGCCGGACTAGCAGAGAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940765417 | Original CRISPR | GACTCGGAGGAGGTGTGCCC AGG (reversed) | Intronic | ||