ID: 940765419 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:157784818-157784840 |
| Sequence | TCCGGCATTAGACTCGGAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940765419_940765422 | -7 | Left | 940765419 | 2:157784818-157784840 | CCTCCTCCGAGTCTAATGCCGGA | No data | ||
| Right | 940765422 | 2:157784834-157784856 | TGCCGGACTAGCAGAGAGAGAGG | No data | ||||
| 940765419_940765424 | 13 | Left | 940765419 | 2:157784818-157784840 | CCTCCTCCGAGTCTAATGCCGGA | No data | ||
| Right | 940765424 | 2:157784854-157784876 | AGGCAGACCAAAGAACATCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940765419 | Original CRISPR | TCCGGCATTAGACTCGGAGG AGG (reversed) | Intronic | ||