ID: 940765420 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:157784821-157784843 |
Sequence | TAGTCCGGCATTAGACTCGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
940765420_940765424 | 10 | Left | 940765420 | 2:157784821-157784843 | CCTCCGAGTCTAATGCCGGACTA | No data | ||
Right | 940765424 | 2:157784854-157784876 | AGGCAGACCAAAGAACATCGTGG | No data | ||||
940765420_940765422 | -10 | Left | 940765420 | 2:157784821-157784843 | CCTCCGAGTCTAATGCCGGACTA | No data | ||
Right | 940765422 | 2:157784834-157784856 | TGCCGGACTAGCAGAGAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
940765420 | Original CRISPR | TAGTCCGGCATTAGACTCGG AGG (reversed) | Intronic | ||