ID: 940765420

View in Genome Browser
Species Human (GRCh38)
Location 2:157784821-157784843
Sequence TAGTCCGGCATTAGACTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940765420_940765424 10 Left 940765420 2:157784821-157784843 CCTCCGAGTCTAATGCCGGACTA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765420_940765422 -10 Left 940765420 2:157784821-157784843 CCTCCGAGTCTAATGCCGGACTA No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940765420 Original CRISPR TAGTCCGGCATTAGACTCGG AGG (reversed) Intronic