ID: 940765422

View in Genome Browser
Species Human (GRCh38)
Location 2:157784834-157784856
Sequence TGCCGGACTAGCAGAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940765419_940765422 -7 Left 940765419 2:157784818-157784840 CCTCCTCCGAGTCTAATGCCGGA No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data
940765415_940765422 16 Left 940765415 2:157784795-157784817 CCTCAGTTCACCACCTGGGCACA No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data
940765420_940765422 -10 Left 940765420 2:157784821-157784843 CCTCCGAGTCTAATGCCGGACTA No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data
940765416_940765422 6 Left 940765416 2:157784805-157784827 CCACCTGGGCACACCTCCTCCGA No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data
940765417_940765422 3 Left 940765417 2:157784808-157784830 CCTGGGCACACCTCCTCCGAGTC No data
Right 940765422 2:157784834-157784856 TGCCGGACTAGCAGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940765422 Original CRISPR TGCCGGACTAGCAGAGAGAG AGG Intronic