ID: 940765423

View in Genome Browser
Species Human (GRCh38)
Location 2:157784836-157784858
Sequence TGCCTCTCTCTCTGCTAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940765423_940765426 21 Left 940765423 2:157784836-157784858 CCGGACTAGCAGAGAGAGAGGCA No data
Right 940765426 2:157784880-157784902 TTTAAAAACTGTCCACAATTTGG No data
940765423_940765424 -5 Left 940765423 2:157784836-157784858 CCGGACTAGCAGAGAGAGAGGCA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940765423 Original CRISPR TGCCTCTCTCTCTGCTAGTC CGG (reversed) Intronic