ID: 940765424

View in Genome Browser
Species Human (GRCh38)
Location 2:157784854-157784876
Sequence AGGCAGACCAAAGAACATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940765419_940765424 13 Left 940765419 2:157784818-157784840 CCTCCTCCGAGTCTAATGCCGGA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765421_940765424 7 Left 940765421 2:157784824-157784846 CCGAGTCTAATGCCGGACTAGCA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765420_940765424 10 Left 940765420 2:157784821-157784843 CCTCCGAGTCTAATGCCGGACTA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765423_940765424 -5 Left 940765423 2:157784836-157784858 CCGGACTAGCAGAGAGAGAGGCA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765416_940765424 26 Left 940765416 2:157784805-157784827 CCACCTGGGCACACCTCCTCCGA No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data
940765417_940765424 23 Left 940765417 2:157784808-157784830 CCTGGGCACACCTCCTCCGAGTC No data
Right 940765424 2:157784854-157784876 AGGCAGACCAAAGAACATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940765424 Original CRISPR AGGCAGACCAAAGAACATCG TGG Intronic