ID: 940765973

View in Genome Browser
Species Human (GRCh38)
Location 2:157789951-157789973
Sequence GAGAACAATATGAAGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940765971_940765973 25 Left 940765971 2:157789903-157789925 CCTTTCTCTCAAAGAGAAAACTT No data
Right 940765973 2:157789951-157789973 GAGAACAATATGAAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940765973 Original CRISPR GAGAACAATATGAAGTCTTC AGG Intronic
No off target data available for this crispr