ID: 940771587

View in Genome Browser
Species Human (GRCh38)
Location 2:157844698-157844720
Sequence CAGCAGCTCTTGAGGTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940771587_940771592 18 Left 940771587 2:157844698-157844720 CCTTTTGACCTCAAGAGCTGCTG No data
Right 940771592 2:157844739-157844761 CCCCACAAGAATTCATACATTGG No data
940771587_940771590 -8 Left 940771587 2:157844698-157844720 CCTTTTGACCTCAAGAGCTGCTG No data
Right 940771590 2:157844713-157844735 AGCTGCTGTGGTCTGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940771587 Original CRISPR CAGCAGCTCTTGAGGTCAAA AGG (reversed) Intronic
No off target data available for this crispr