ID: 940775027

View in Genome Browser
Species Human (GRCh38)
Location 2:157876122-157876144
Sequence CGGGGTGAAGAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2024
Summary {0: 1, 1: 1, 2: 14, 3: 194, 4: 1814}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940775021_940775027 -4 Left 940775021 2:157876103-157876125 CCGGGGGAGGGCGGGGAGGCGGG 0: 1
1: 1
2: 17
3: 170
4: 1284
Right 940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 14
3: 194
4: 1814
940775013_940775027 9 Left 940775013 2:157876090-157876112 CCGGGGGAAAGAGCCGGGGGAGG 0: 1
1: 0
2: 4
3: 29
4: 359
Right 940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 14
3: 194
4: 1814
940775009_940775027 13 Left 940775009 2:157876086-157876108 CCACCCGGGGGAAAGAGCCGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
Right 940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 14
3: 194
4: 1814
940775012_940775027 10 Left 940775012 2:157876089-157876111 CCCGGGGGAAAGAGCCGGGGGAG 0: 1
1: 0
2: 1
3: 31
4: 275
Right 940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG 0: 1
1: 1
2: 14
3: 194
4: 1814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940775027 Original CRISPR CGGGGTGAAGAGGAGGAGGA AGG Intergenic
Too many off-targets to display for this crispr