ID: 940777811

View in Genome Browser
Species Human (GRCh38)
Location 2:157902940-157902962
Sequence CACCCACTCCTTGGTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940777811_940777813 1 Left 940777811 2:157902940-157902962 CCAGTTGCACCAAGGAGTGGGTG No data
Right 940777813 2:157902964-157902986 AGTAGAAATTCAGTATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940777811 Original CRISPR CACCCACTCCTTGGTGCAAC TGG (reversed) Intronic
No off target data available for this crispr