ID: 940778230

View in Genome Browser
Species Human (GRCh38)
Location 2:157906354-157906376
Sequence AGGATATTACAAATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940778221_940778230 -3 Left 940778221 2:157906334-157906356 CCCGCTCTCGCCCCGCAGCCAGG No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data
940778216_940778230 30 Left 940778216 2:157906301-157906323 CCATTTGGTCCAAATCAGGCCAA No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data
940778220_940778230 -2 Left 940778220 2:157906333-157906355 CCCCGCTCTCGCCCCGCAGCCAG No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data
940778219_940778230 -1 Left 940778219 2:157906332-157906354 CCCCCGCTCTCGCCCCGCAGCCA No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data
940778218_940778230 11 Left 940778218 2:157906320-157906342 CCAATGAAAACTCCCCCGCTCTC No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data
940778217_940778230 21 Left 940778217 2:157906310-157906332 CCAAATCAGGCCAATGAAAACTC No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data
940778223_940778230 -4 Left 940778223 2:157906335-157906357 CCGCTCTCGCCCCGCAGCCAGGA No data
Right 940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940778230 Original CRISPR AGGATATTACAAATGGAGGA TGG Intronic
No off target data available for this crispr