ID: 940778644

View in Genome Browser
Species Human (GRCh38)
Location 2:157910259-157910281
Sequence AGAGCTAGTGGGATGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940778644_940778659 28 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778659 2:157910310-157910332 GATTTGGCCGTGGAGGTGGTGGG No data
940778644_940778660 29 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778660 2:157910311-157910333 ATTTGGCCGTGGAGGTGGTGGGG No data
940778644_940778657 24 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778657 2:157910306-157910328 CCTAGATTTGGCCGTGGAGGTGG No data
940778644_940778654 18 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data
940778644_940778655 21 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778655 2:157910303-157910325 GCTCCTAGATTTGGCCGTGGAGG No data
940778644_940778661 30 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778661 2:157910312-157910334 TTTGGCCGTGGAGGTGGTGGGGG No data
940778644_940778651 -1 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778651 2:157910281-157910303 TGCAGTGAGGGGTAGCTCCATGG No data
940778644_940778658 27 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778658 2:157910309-157910331 AGATTTGGCCGTGGAGGTGGTGG No data
940778644_940778652 12 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778652 2:157910294-157910316 AGCTCCATGGCTCCTAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940778644 Original CRISPR AGAGCTAGTGGGATGGCATA AGG (reversed) Intronic
No off target data available for this crispr