ID: 940778645

View in Genome Browser
Species Human (GRCh38)
Location 2:157910266-157910288
Sequence TCACTGCAGAGCTAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940778645_940778658 20 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778658 2:157910309-157910331 AGATTTGGCCGTGGAGGTGGTGG No data
940778645_940778660 22 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778660 2:157910311-157910333 ATTTGGCCGTGGAGGTGGTGGGG No data
940778645_940778659 21 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778659 2:157910310-157910332 GATTTGGCCGTGGAGGTGGTGGG No data
940778645_940778657 17 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778657 2:157910306-157910328 CCTAGATTTGGCCGTGGAGGTGG No data
940778645_940778661 23 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778661 2:157910312-157910334 TTTGGCCGTGGAGGTGGTGGGGG No data
940778645_940778663 29 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778663 2:157910318-157910340 CGTGGAGGTGGTGGGGGAGCAGG No data
940778645_940778651 -8 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778651 2:157910281-157910303 TGCAGTGAGGGGTAGCTCCATGG No data
940778645_940778655 14 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778655 2:157910303-157910325 GCTCCTAGATTTGGCCGTGGAGG No data
940778645_940778654 11 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data
940778645_940778652 5 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778652 2:157910294-157910316 AGCTCCATGGCTCCTAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940778645 Original CRISPR TCACTGCAGAGCTAGTGGGA TGG (reversed) Intronic
No off target data available for this crispr