ID: 940778648

View in Genome Browser
Species Human (GRCh38)
Location 2:157910270-157910292
Sequence CCCCTCACTGCAGAGCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940778648_940778663 25 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778663 2:157910318-157910340 CGTGGAGGTGGTGGGGGAGCAGG No data
940778648_940778652 1 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778652 2:157910294-157910316 AGCTCCATGGCTCCTAGATTTGG No data
940778648_940778655 10 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778655 2:157910303-157910325 GCTCCTAGATTTGGCCGTGGAGG No data
940778648_940778661 19 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778661 2:157910312-157910334 TTTGGCCGTGGAGGTGGTGGGGG No data
940778648_940778659 17 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778659 2:157910310-157910332 GATTTGGCCGTGGAGGTGGTGGG No data
940778648_940778657 13 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778657 2:157910306-157910328 CCTAGATTTGGCCGTGGAGGTGG No data
940778648_940778658 16 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778658 2:157910309-157910331 AGATTTGGCCGTGGAGGTGGTGG No data
940778648_940778660 18 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778660 2:157910311-157910333 ATTTGGCCGTGGAGGTGGTGGGG No data
940778648_940778654 7 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940778648 Original CRISPR CCCCTCACTGCAGAGCTAGT GGG (reversed) Intronic
No off target data available for this crispr