ID: 940778654

View in Genome Browser
Species Human (GRCh38)
Location 2:157910300-157910322
Sequence ATGGCTCCTAGATTTGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940778650_940778654 6 Left 940778650 2:157910271-157910293 CCACTAGCTCTGCAGTGAGGGGT No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data
940778645_940778654 11 Left 940778645 2:157910266-157910288 CCATCCCACTAGCTCTGCAGTGA No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data
940778644_940778654 18 Left 940778644 2:157910259-157910281 CCTTATGCCATCCCACTAGCTCT No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data
940778648_940778654 7 Left 940778648 2:157910270-157910292 CCCACTAGCTCTGCAGTGAGGGG No data
Right 940778654 2:157910300-157910322 ATGGCTCCTAGATTTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940778654 Original CRISPR ATGGCTCCTAGATTTGGCCG TGG Intronic
No off target data available for this crispr