ID: 940780497

View in Genome Browser
Species Human (GRCh38)
Location 2:157928304-157928326
Sequence ATGACTCTGAATCAGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940780497_940780500 16 Left 940780497 2:157928304-157928326 CCATCATACTGATTCAGAGTCAT No data
Right 940780500 2:157928343-157928365 TTGGTTGATAAATGAACAACTGG No data
940780497_940780498 -3 Left 940780497 2:157928304-157928326 CCATCATACTGATTCAGAGTCAT No data
Right 940780498 2:157928324-157928346 CATTTCAGCTATTTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940780497 Original CRISPR ATGACTCTGAATCAGTATGA TGG (reversed) Intronic
No off target data available for this crispr