ID: 940784630

View in Genome Browser
Species Human (GRCh38)
Location 2:157968200-157968222
Sequence TCGCGCTGGCCCACAAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940784625_940784630 -6 Left 940784625 2:157968183-157968205 CCATGCCCACCTGGAACTCGCGC No data
Right 940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG No data
940784621_940784630 25 Left 940784621 2:157968152-157968174 CCGGCGGCTCCGAGTGCGGGGTC No data
Right 940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG No data
940784617_940784630 29 Left 940784617 2:157968148-157968170 CCGGCCGGCGGCTCCGAGTGCGG No data
Right 940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG No data
940784623_940784630 3 Left 940784623 2:157968174-157968196 CCGCTGAGTCCATGCCCACCTGG No data
Right 940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG No data
940784622_940784630 16 Left 940784622 2:157968161-157968183 CCGAGTGCGGGGTCCGCTGAGTC No data
Right 940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940784630 Original CRISPR TCGCGCTGGCCCACAAGCAC CGG Intronic
No off target data available for this crispr