ID: 940795252

View in Genome Browser
Species Human (GRCh38)
Location 2:158070867-158070889
Sequence AGGGAGAGCACAGTGACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940795245_940795252 23 Left 940795245 2:158070821-158070843 CCAGAGCTGCTACATGGCATGGA No data
Right 940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG No data
940795242_940795252 25 Left 940795242 2:158070819-158070841 CCCCAGAGCTGCTACATGGCATG No data
Right 940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG No data
940795243_940795252 24 Left 940795243 2:158070820-158070842 CCCAGAGCTGCTACATGGCATGG No data
Right 940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940795252 Original CRISPR AGGGAGAGCACAGTGACTGT AGG Intronic