ID: 940801094

View in Genome Browser
Species Human (GRCh38)
Location 2:158133405-158133427
Sequence GCAAAATTTCAGTTACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940801085_940801094 28 Left 940801085 2:158133354-158133376 CCAGAGTATAGGGGAGCAGGATG No data
Right 940801094 2:158133405-158133427 GCAAAATTTCAGTTACAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940801094 Original CRISPR GCAAAATTTCAGTTACAAGG AGG Intronic
No off target data available for this crispr